Journal of Plant Biotechnology : eISSN 2384-1397 pISSN 1229-2818

Table. 2.

Table. 2.

List of the 12 SSR markers used in this study

No.Name5’-3’ sequenceTa (°C)Size Range of Alleles
1.Mn-89F: CGCCGAGCCTATAACCTCTA R: ATCATGCCCTAAACGACGAC45110-140 bp
2.Mn-19F: AATTATCCTATCCCTCGTATC R: AGAAACATGATGTGAACC55130-180 bp
3.Mn -84F: TCTATAAGTGCCCCCTCACG R: ACTGCCACCGTGGAAAGTAG55210-350 bp
4.Mn-16F: GCTTTATCCACATCAATATCC R: TCCTACAATAACTTGCC55150-180 bp
5.LMMA 8F: CATGGAGTTGTTGATACCTAC R: CAGAGTTAGCCATATAGAGTG55250-310 bp
6.MiSHRS 39F: GAACGAGAAATCGGGAAC R: GCAGCCATTGAATACAGAG55340-370 bp
7.Mn-36F: CCTCAATCTCACTCAACA R: ACCCCACAATCAAACTAC45220-300 bp
8.Mn-85F: GCTTGCTTCCAACTGAGACC R: GCAAAATGCTCGGAGAAGAC53250-310 bp
9.MngSSR-24F: CGATGGACTTCATAAGAAGAG R: GCTAGCAGAATCACCTTGGTC53150-180 bp
10.MiIIHR04F: CGTTTTTGACCCTCTTGAGC R: CCGCATACTTCCCTTCACAT55140-190 bp
11.MiL27F: AAGACATCATGGCCACTTGAC R: CGAAGACCATGGTGGATTA55330-360 bp
12.Mn-83F: AGCTATCGCCACAGCAAATC R: GTCTTCTTCTGGCTGCCAAC55190-213 bp
J Plant Biotechnol 2019;46:61-70 https://doi.org/10.5010/JPB.2019.46.2.061
© 2019 J Plant Biotechnol