Journal of Plant Biotechnology : eISSN 2384-1397 pISSN 1229-2818

Table. 2.

Table. 2.

Primers used for maize multiplex PCR

target Primer Name Sequence (5’-3’) GC (%) Product Size (bp)
Adh1 Adh1-F CGTGGTTTGCTTGCCCACA 58 179
Adh1-R CCACTCCGAGACCCTCAGTC 65
5307 5307L-JV1 ATTATCGCGCGCGGTGTCAT 55 183
5307L-P1 TGCACCCTTTGCCAGTGG 61
DAS-40278-9 DAS-40278-9L-P2 CAGGAGACCTCGCTTGTAACC 57 215
DAS-40278-9L-JV1 TGGTTCATTGTATTCTGGCTTTG 39
MON87460 MON87460R-F4 GATGATCTACCATCCACGGATC 50 319
MON87460R-JV1 TCGCGATCCTCCTCAAAGAC 55
MON87427 MON87427R-F6 GTGTACATTTAGCTACATCCGATG 42 363
MON87427R-JP1 CCATGTAGATTTCCCGGTTTTCTC 46
J Plant Biotechnol 2020;47:309-15 https://doi.org/10.5010/JPB.2020.47.4.309
© 2020 J Plant Biotechnol