Journal of Plant Biotechnology : eISSN 2384-1397 pISSN 1229-2818

Table. 2.

Table. 2.

Primers and restriction enzymes for generating S. brevicaule-specific markers

Marker name Region Sa Primer sequence Size (bp)b REc
SB2_SNP_3 rbcL(Intragenic) F AATACCATGGTCTAATAATC 688 HpaII
R TAATAGTACATCCCAACAGG
SB2_SNP_5 rpl36-rps8(Intergenic) F AATAACTCCCTTTGGTATTC 653 HphI
R TGTGTTATATCTGGTAATCC
SB2_SNP_8 ndhI-ndhA(Intergenic) F TACGGAATAGAAAGATTCC 680 HinfI
R ATTCATGAACTAATGTACTC

aF and R indicate forward and reverse strand of primers.

bThe expected size of PCR fragments is measured on the basis of the sequence of S. brevicaule.

cRestriction enzymes generating S. brevicaule-specific markers.

J Plant Biotechnol 2022;49:30-8 https://doi.org/10.5010/JPB.2022.49.1.030
© 2022 J Plant Biotechnol