search for




 

Development of transgenic potato with improved anthocyanin contents using sweet potato IbMYB1 gene
J Plant Biotechnol 2018;45:364-368
Published online December 31, 2018
© 2018 The Korean Society for Plant Biotechnology.

Yun-Hee Kim, Eun-Hee Han, Sang-Soo Kwak, and Shin-Woo Lee

Department of Biology Education, College of Education, IALS, Gyeongsang National University, Jinju, Korea,
Medicinal Recourses Research Institute, Gyeongnam Agricultural Research & Extension Services,
Plant Systems Engineering Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon, Korea,
Department of Agronomy & Medicinal Plant Resources, Gyeongnam National University of Science & Technology, JinJu, Korea
Correspondence to: e-mail: shinwlee@gntech.ac.kr
Received October 22, 2018; Revised November 6, 2018; Accepted November 6, 2018.
cc This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

The R2R3-type protein IbMYB1 transcription factor is a key regulator for anthocyanin biosynthesis in the storage roots of sweet potatoes. It was previously demonstrated that the IbMYB1 expression stimulates anthocyanin pigmentation in tobacco leaves, arabidopsis and storage roots of sweet potatoes. In this study, we generated the transgenic potato plants that express the IbMYB1 genes, which accumulated high levels of anthocyanins under the control of either the tuber-specific patatin (PAT) promoter or oxidative stress-inducible peroxidase anionic 2 (SWPA2) promoter. The PAT-MYB1 transgenic lines exhibited higher anthocyanin levels in the tuber than the empty vector control (EV) or SWPA2-MYB1 plants. When combined, our results indicated that overexpression of the IbMYB1 is a highly promising strategy for the generation of transgenic plants with enhanced tissue specific anthocyanin production.

Keywords : Anthocyanin, IbMYB1, Transgenic potato, Tuber specific promoter
서언

많은 고등 식물의 조직과 기관들은 안토시아닌, 카로티노이드, 엽록소와 같은 다양한 색소의 합성과 축적으로 여러 가지 색을 나타낸다(Tanaka et al. 2008). 이들 중 안토시아닌은 수용성의 플라보노이드 계열의 색소로서 꽃, 과실, 줄기, 잎, 뿌리 등에 함유되어 있다(Holton and Comish 1995). 식물성 천연색소인 안토시아닌은 세포질 혹은 액포 내에 배당체로 존재하며, 세포액의 산성 농도, 색소 화합물의 화학적 구조, 여러 금속이온들과의 결합 상태 등에 의해 자색, 적색, 청색 등의 다양한 색을 발현하는 색소이다. 또한 생체내에서 항균, 항노화, 항콜레스테롤, 항궤양, 항산화 등의 다양한 생리활성 기능이 있는 것으로 알려져 있다(Chen et al. 2005; Teow et al. 2007). 그러므로 이와 같은 안토시아닌의 다양한 생리 활성적 특징으로 인해 안토시아닌은 기능성 식품, 화장품, 의약품, 천연 염료 등에 많이 활용되고 있다. 현재까지 안토시아닌 이용에 관한연구는 주로 색의 변화가 상품성과 관련되는 화훼나 과수분야에서 많이 진행되어 왔지만, 최근에는 기능성 작물에 대한 관심이 높아지면서 식량작물에서도 많은 연구가 진행되고 있는 실정이다.

식물의 R2R3 유형의 MYB 전사인자는 식물의 생장 및 발달과 관련된 다양한 기능을 수행한다(Allan et al. 2008). 이들 중 안토시아닌 생합성을 조절하는 MYB 전사인자는 다양한 식물종에서 보고 된 바 있다. 다양한 식물 유래의 R2R3 유형 MYB 전사인자의 과발현에 의한 안토시아닌 생성 여부를 조사한 결과, 옥수수(Cone et al. 1993), 애기장대(Borevitz et al. 2000), 포도 및 사과 유래의 MYB 전사인자들이 안토시아닌 합성을 증가시키는 결과를 보였다(Kobayashi et al. 2002; Espley et al. 2007; Espley et al. 2013). 또한 고구마 유래 IbMYB1 유전자의 일시적 발현을 통해 담배 잎에서 안토시아닌의 생합성이 활성화 되는 것을 확인한 바 있으며, 실제로 IbMYB1 유전자의 과발현에 의하여 담배의 안토시아닌 생합성 관련 주요 유전자들 (CHS, ANS, DFR)의 발현이 대조구에 비해 크게 증가됨이 확인 되었다(Mano et al. 2007; Kim et al. 2010). 또한 형질전환 고구마 식물체에서도 IbMYB1의 조절하에 고구마의 안토시아닌 생합성 유전자들의 전사적 수준의 발현 증가가 안토시아닌의 생성을 증가시킴이 확인되었다(Park et al. 2015). 그러므로, IbMYB1을 이용한 안토시아닌의 생합성과 대사과정을 분자육종 방법으로 조절하면 안토시아닌 및 항산화 활성을 고함유한 유용물질 고함유 기능성 작물 개발에 활용 가능할 것으로 사료되어 많은 연구가 수행되고 있다.

본 연구팀은 선행연구의 결과로서, 고구마에서 분리한 IbOr 유전자를 이용하여 산화스트레스 유도성 SWPA2 프로모터의 조절하에 과발현 시킨 형질전환 감자를 개발하여 그 특성을 분석하였다(Goo et al. 2015; Cho et al. 2016). 형질전환 감자 식물체들은 비형질전환체 보다 증가된 환경 스트레스에 대한 내성과 카로티노이드 함량을 보인 바 있다. 본 연구에서는 안토시아닌을 생산하는 IbMYB1 유전자 과발현 형질전환 감자 식물체의 개발 및 증가된 안토시아닌 함량을 분석하였다.

재료 및 방법

실험재료

형질전환 감자(Solanum tuberosum L. cv. Jayoung)는 고구마 저장뿌리에서 분리된 IbMYB1 유전자를 괴경 특이적으로 발현되는 patatin (PAT) 프로모터와 산화스트레스 유도성 SWPA2 프로모터의 조절하에 위치하도록 제작한 재조합운반체를 이용하여 아그로박테리움 감염법을 이용하여 제작하였다(Fig. 1). 제작된 형질전환 식물체를 MS (Murashige and Skoog 1962) 배지에 sucrose 3%를 첨가하여 16시간의 광 조건에서 40 umol m-2 sec-1의 형광 및 25°C의 배양실 조건에서 배양하여 유지하였다.

Fig. 1.

Schematic diagram for the T-DNA region of the PAT-IbMYB1 and SWPA2-IbMYB1 constructs used for plant transformation. PAT Pro, patatin promoter; SWPA2 pro, sweet potato peroxidase SWPA2 promoter; SPO ter, sporamin terminator


DNA 분리 및 도입 유전자 확인

배양된 유식물체의 잎 조직을 액체질소에 급속 냉동 시킨 후 곱게 갈아서 얻은 분말을 이용하여 GeneAll사의 ExgeneTM Plant SV 키트를 이용하여 회사에서 제공한 실험방법에 따라 염색체 DNA를 분리하였다. 정제된 DNA는 1% agarose gel에서 전기영동을 실시하여 DNA의 분리과정에서의 분해정도를 확인한 후 Micro-spectrometer (BioPrince, SD-2000, Gangwon, South Korea)를 이용하여 234 nm, 260 nm, 280 nm에서 각각 흡광도를 측정하여 A260/A280 값이 1.8 ~ 2.2 범위 그리고 A234/ A260 값이 0.5 ~ 0.8 범위 내 포함 여부를 조사하여 RNA 및 단백질 등의 오염 정도를 확인하여 순수한 DNA를 확인하였다.

식물체 내의 도입 유전자를 확인하고자 유전자 단편의 증폭을 위하여 Table 1에 표시된 프라이머를 사용하여 PCR 반응을 수행하였다. 제조사에서 제공하는 실험방법에 따라 순수 분리한 DNA와 프라이머를 각각 혼합 한 후 94°C에서 5분간 DNA를 변성 시킨 후 94°C에서 30초, 60°C에서 10초, 72°C에서 30초를 1 cycle로 하여 30 cycle 반복 후 72°C에서 5분간 연장반응을 시킨 후 4°C에서 반응을 종료하고 증폭된 DNA밴드는 1.0% agarose gel을 이용하여 전기영동하여 그 결과를 확인하였다.

Primer sequences used in this study

Target genePrimersSequences (5’–3’)
NPTIINPTII forwardGAGGCTATTCGGCTATGACTG
NPTII reverseATCGGGAGCGGCGATACCGTA

SWPA2-IbMYB1SWPA2 forwardGAAACCTTAGAGGCAATTCATGCA
IbMYB1 reverseTTAAAATAGTAAGATGAAAGTGAATTTAAC

PAT-IbMYB1PAT forwardAAGCTTATACTTTGAGTGACACAC
IbMYB1 reverseTTAAAATAGTAAGATGAAAGTGAATTTAAC

안토시아닌 함량분석

안토시아닌 함량분석은 Dubos et al. (2008)의 방법을 이용하였다. 200 mg 시료에 1% HCl이 첨가된 300 µl의 acidic methanol을 넣어 4°C 저온에서 빛을 차단한 후 shaking incubation 하였다. 200 µl의 water와 500 µl의 chloroform을 넣어 추출 한 후, supernatant를 이용하여 530 nm와 657 nm에서 흡광도 값을 측정하였다. Background를 제거 하기 위해 530 nm 흡광도 값에서 657 nm 흡광도 값을 빼 주고 authentic cyanidin으로 calibration curve를 만들어 안토시아닌 함량을 계산하였다.

결과 및 고찰

형질전환 감자에서 도입 유전자의 확인

Agrobacterium과 공동 배양한 감자의 잎 또는 줄기 절편체를 MS 기본배지에 2 mg/L zeatin, 0.01 mg/L NAA, 0.1 mg/L GA3, 400 mg/L claforan, 100 mg/L kanamycin이 포함된 선발배지에서 배양하였다. Kanamycin 저항성을 지닌 지상부는 선발배지에서 약 3 ~ 4주 정도 배양되었을 때 캘러스와 함께 유도되었다(데이터 미제시). 잎이 1 ~ 2장 정도 나왔을대 뿌리 유도배지로 옮겨 유식물체의 뿌리를 유도하였다. 뿌리가 발달된 유식물체를 kanamycin이 함유된 MS 기본배지로 옮겨 줄기와 뿌리가 발달된 식물체로 성장하였다. Kanamycin 배지에서 선발된 유식물체를 대상으로 kanamycin 저항성 NPTII 유전자 및 PATATIN 프로모터와 IbMYB1 유전자 특이적 프라이머, SWPA2 프로모터와 IbMYB1 유전자 특이적 프라이머를 이용하여 PCR을 수행하였다(Fig. 2). NPTII 프라이머의 경우, 277 bp의 밴드가 확인되었으며, PATATIN 프로모터와 IbMYB1 유전자 특이적 프라이머는 273 bp, SWPA2 프로모터와 IbMYB1 유전자 특이적 프라이머는 276 bp의 DNA 단편이 확인되었다. 그러나 형질전환 시키지 않은 대조구 식물체에서는 어떤 밴드도 나타나지 않았다. 이를 통해 외래 유전자가 안정적으로 도입된 형질전환 감자 식물체를 확인하였다.

Fig. 2.

The results for the PCR analysis for the confirmation of transgenic potato plants bearing the IbMYB1 gene. A Genomic DNA was purified from the candidate transgenic potato plants and PCR was carried out with primer sets for the NPTII gene. B Genomic DNA was purified from the candidate transgenic potato plants. The PCR was carried out with primer sets for the PAT-IbMYB1 or SWPA2-IbMYB1 constructs. The PCR products were fractionated on 1.0% agarose gel. M: size marker; EV: empty vector, WT: Wild-type (negative control), P: positive control


형질전환 감자에서 증가된 안토시아닌의 함량 확인

뿌리가 발달한 유식물체를 토양으로 옮겨 재배한 결과, 괴경이 형성되었다. 형질전환 식물체와 대조구 식물체의 생육에는 외형적으로 차이가 없었으며, PAT-MYB1 형질전환 식물체의 괴경은 내부가 진한 자색의 표현형을 나타내는 것을 확인할 수 있었다(Fig. 3). 반면에 SWPA2-MYB1 형질전환 식물체의 괴경은 옅은 자색을 나타내는 것을 확인할 수 있었다.

Fig. 3.

The phenotypes of potato lines overexpressing the IbMYB1 gene. Each selected PAT-IbMYB1 and SWPA2-IbMYB1 overexpression lines, empty vector (EV) line and wild-type (WT) line. Pictures of whole plants and tubers were obtained from the WT, EV and IbMYB1 transgenic lines


각 식물체의 안토시아닌 함량을 분석한 결과, PAT-MYB1 형질전환 식물체의 괴경이 대조구인 비형질전환체 보다 약 3.0 ~ 3.2배 높은 안토시아닌 함량을 보이는 것을 확인할 수 있었다(Fig. 4). 반면에 SWPA2-MYB1 형질전환 식물체의 괴경은 대조구인 비형질전환체 보다 약 1.3배 높은 안토시아닌 함량을 보이는 것을 확인할 수 있었다.

Fig. 4.

Anthocyanin contents of the tubers of potato lines overexpressing the IbMYB1 gene. An anthocyanin quantification was performed from the readings, which were measured at 530 nm and 657 nm. The reading at 657 nm was subtracted from reading at 530 nm to eliminate any interference. Authentic cyaniding glucoside was used to generate the calibration curve


선행연구 결과에서 형질전환 고구마 식물체에서 저장뿌리 특이적 Sporamin (SPO) 프로모터와 SWPA2 프로모터를 이용하여 IbMYB1 유전자를 과발현 시킨 형질전환 고구마 식물체에서도 일치하게 SPO-MYB1 과발현 벡터가 SWPA2-MYB1 과발현 벡터보다 높은 안토시아닌 생산량을 저장뿌리에서 나타냄을 확인할 수 있었다(Park et al. 2015). 그러므로, 특정 조직 특이적으로 안토시아닌 생합성을 증가시키기 위해서는 조직 특이적 프로모터를 이용한 벡터 시스템이 매우 효율적인 것으로 생각된다.

이상의 결과로부터 전사인자인 IbMYB1 유전자가 도입된 형질전환 감자 식물체는 도입된 외래 유전자에 의해 안토시아닌의 함량이 안정적으로 증가함을 확인하였다. 또한 사용한 발현벡터의 프로모터의 조절특성에 따라 괴경 특이적 PAT 프로모터 및 산화스트레스 유도성 SWPA2 프로모터에 의한 조절에 의해 안토시아닌의 생합성이 비형질전환체 보다 증가하는 것을 확인할 수 있었다. 따라서, 본 연구에 사용한 IbMYB1 유전자를 과발현 시킨 형질전환 감자는 최근 들어 심각하게 나빠지고 있는 환경조건에 대비하여 높은 안토시아닌 생산에 의한 항산화 활성 증가를 통해 비형질전환체 보다 높게 나타나는 높은 바이오매스 및 환경 적응력을 갖는 감자 품종의 개발을 기대할 수 있는 좋은 소재가 될 것으로 기대되는 바이다.

적요

R2R3 유형의 단백질인 IbMYB1 전사인자는 고구마의 저장뿌리에서 안토시아닌 생합성 과정을 조절하는 중요한 단백질이다. 선행연구에서 IbMYB1 유전자의 발현 증가를 통한 안토시아닌의 합성 증가가 담배, 애기장대 및 고구마의 저장뿌리에서 증명된 바 있다. 본 연구에서는 괴경(저장줄기) 특이적 PATATIN 프로모터와 산화스트레스 유도성 SWPA2 프로모터의 조절하에서 안토시아닌을 고함유하는 IbMYB1 유전자 과발현 형질전환 감자를 개발하여 그 특성을 분석하였다. PAT-IbMYB1 형질전환 식물체들은 대조구 식물체 및 SWPA2-IbMYB1 식물체 보다 높은 안토시아닌 함량을 괴경에서 나타내었다. 본 연구의 결과로서, IbMYB1의 과발현은 형질전환 기술을 이용한 특정 조직 특이적 안토시아닌 생산에 매우 좋은 개발 기술이 될 것으로 생각되는 바이다.

사사

본 연구는 2018년도 경남과학기술대학교 대학회계연구비 지원에 의하여 연구되었음.

References
  1. Allan AC, Hellens RP, and Laing WA. (2008) MYB transcription factors that colour our fruit. Trends Plant Sci 13, 99-102.
    Pubmed CrossRef
  2. Borevitz JO, Xia Y, Blount J, Dixon RA, and Lamb C. (2000) Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12, 2383-2393.
    Pubmed KoreaMed CrossRef
  3. Cone KC, Cocciolone SM, Burr FA, and Burr B. (1993) Maize anthocyanin regulatory gene pl is a duplicate of c1 that functions in the plant. Plant Cell 5, 1795-1805.
    Pubmed KoreaMed CrossRef
  4. Chen PN, Chu SC, Chiou HL, Chiang CL, Yang SF, and Hsieh YS. (2005) Cyanidin 3-glucoside and peonidin 3-glucoside inhibit tumor cell growth and induce apoptosis in vitro and suppress tumor growth in vivo. Nutr Cancer 53, 232-243.
    Pubmed CrossRef
  5. Cho KS, Han EH, Kwak SS, Cho JH, Im JS, Hong SY, Sohn HB, Kim YH, and Lee SW. (2016) Expressing the sweet potato orange gene in transgenic potato improves drought tolerance and marketable tuber production. Compt Rend Biol 339, 207-213.
    Pubmed CrossRef
  6. Dubos C, Le Gourrierec J, Baudry A, Huep G, Lanet E, Debeaujion I, Routaboul JM, Alboresi A, Weisshaar B, and Lepiniec L. (2008) MYBL2 is a new regulator of flavonoid biosynthesis in Arabidopsis thaliana. Plant J 55, 940-953.
    Pubmed CrossRef
  7. Espley RV, Bovy A, Bava C, Jaeger SR, Tomes S, Norling C, Crawford J, Rowan D, McGhie TK, Brendolise C, Putterill J, Schouten HJ, Hellens RP, and Allan AC. (2013) Analysis of genetically modified red-fleshed apples reveals effects on growth and consumer attributes. Plant Biotechnol J 11, 408-419.
    Pubmed CrossRef
  8. Espley RV, Hellens RP, Putterill J, Stevenson DE, Kutty-Amma S, and Allan AC. (2007) Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. Plant J 49, 414-427.
    Pubmed KoreaMed CrossRef
  9. Goo YM, Han EH, Jeong JC, Kwak SS, Yu J, Kim YH, Ahn MJ, and Lee SW. (2015) Overexpression of the sweet potato IbOr gene results in the increased accumulation of carotenoid and confers tolerance to environmental stresses in transgenic potato. Compt Rend Biol 338, 12-20.
    Pubmed CrossRef
  10. Holton , and Comish. (1995) Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 7, 1071-1083.
    Pubmed KoreaMed CrossRef
  11. Kim CY, Ahn YO, Kim SH, Kim YH, Lee HS, Catanach AS, Jacobs JME, Conner AJ, and Kwak SS. (2010) The sweet potato IbMYB1 gene as a potential visible marker for sweet potato intragenic vector system. Physiol Plant 139, 229-240.
    Pubmed
  12. Kobayashi S, Ishimaru M, Hiraoka K, and Honda C. (2002) Myb-related genes of the Kyoho grape (Vitis labruscana) regulate anthocyanin biosynthesis. Planta 215, 924-933.
    Pubmed CrossRef
  13. Mano H, Ogasawara F, Sato K, Higo H, and Minobe Y. (2007) Isolation of a regulatory gene of anthocyanin biosynthesis in tuberous roots of purple-fleshed sweet potato. Plant Physiol 143, 1252-1268.
    Pubmed KoreaMed CrossRef
  14. Murashige T, and Skoog F. (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15, 473-497.
    CrossRef
  15. Park SC, Kim YH, Kim SH, Jeong YJ, Kim CY, Lee JS, Bae JY, Ahn MJ, Jeong JC, Lee HS, and Kwak SS. (2015) Overexpression of the IbMYB1 gene in an orange-fleshed sweet potato cultivar produces a dual-pigmented transgenic sweet potato with improved antioxidant activity. Physiol Plant 153, 525-537.
    Pubmed CrossRef
  16. Tanaka Y, Sasaki N, and Ohmiya A. (2008) Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. Plant J 54, 733-749.
    Pubmed CrossRef
  17. Teow CC, Truong V-D, McFeeters RF, Thompson RL, Pecota KV, and Yencho GC. (2007) Antioxidant activities, phenolic and β-carotene contents of sweet potato genotypes with varying flesh colours. Food Chem 103, 829-838.
    CrossRef


December 2018, 45 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • CrossMark
  • Crossref TDM